View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11453A_low_173 (Length: 330)

Name: NF11453A_low_173
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11453A_low_173
NF11453A_low_173
[»] chr1 (1 HSPs)
chr1 (101-178)||(13275152-13275228)


Alignment Details
Target: chr1 (Bit Score: 62; Significance: 9e-27; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 101 - 178
Target Start/End: Original strand, 13275152 - 13275228
Alignment:
101 aatatgcagattataataaatttttcagcatgaaacgcaccaaaaaagggagcaaaaatttagttttgagttaaagtt 178  Q
    |||||||||||||||| |||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||    
13275152 aatatgcagattataagaaatttttcagcatgaaacgca-cgaaaaagggagcaaaaatttagttttgagttaaagtt 13275228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University