View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_192 (Length: 323)
Name: NF11453A_low_192
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_192 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 316
Target Start/End: Original strand, 31718167 - 31718475
Alignment:
| Q |
1 |
tggtgtttattataaattgcaatgagtatattattggctgtttgttttcttgcttcccatctttagctgaacagtgggaatgatgaagatgatcttactg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31718167 |
tggtgtttattataaattgcaatgagtatatt---ggctgtttgttttcttgcttcccatctttagctgaacagtgggaatgatgaagatgatcttactg |
31718263 |
T |
 |
| Q |
101 |
atgaccgggaagatcttgatgaagcgggaaattcgtgtcaagatgcatcagatgaatgccttaaaagtgaatcgatcgatttccatgtgcctagccaccc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
31718264 |
atgaccgggaagatcttgatgaagcgggaaattcgtgtcaatatgcatcagatgaatgccttaagagtgaatcg----atttccatgtgcctagccaccc |
31718359 |
T |
 |
| Q |
201 |
tcagtatgatattgaacttcaataactctttggtttggaaatgttgtaaaatttggctgttgcattggctcttgtttcaatcttttatggttgccgaagt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31718360 |
ccagtatgatattgaacttcaataactctttggtttggaaatgttgtaaaatttggctgttgcattggctcttgtttcaatcttttatggttgccgaagt |
31718459 |
T |
 |
| Q |
301 |
taaagaaatatgaaat |
316 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
31718460 |
taaagaaatatgaaat |
31718475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University