View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_213 (Length: 305)
Name: NF11453A_low_213
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_213 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 23 - 231
Target Start/End: Original strand, 5012388 - 5012599
Alignment:
| Q |
23 |
gatgaaatggtagatg---atgatgatactggtttttctacctgagatgatatttttgtaacaaaagattgaggggtgcactaagtaatgtctaataacc |
119 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
5012388 |
gatgaaatggtagatgatgatgatgatactggtttttctacctgagatgatatttttgtaacaaaagattgaggggtgcactaagtaatgtctaatcaac |
5012487 |
T |
|
| Q |
120 |
tatttcagttttcaaaaggtttgcctccctttaactatatgttagtacctactttttgtaaaagtttcttgcatctagtttccttgacgatagatttgct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5012488 |
tatttcagttttcaaaaggtttgcctccctttaactatatgttagtacctactttttgtaaaagtttcttgcatctagtttccttgacgatagatttgct |
5012587 |
T |
|
| Q |
220 |
ggattaagggac |
231 |
Q |
| |
|
|||||||||||| |
|
|
| T |
5012588 |
ggattaagggac |
5012599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 229 - 295
Target Start/End: Original strand, 5012623 - 5012689
Alignment:
| Q |
229 |
gacaatcttctagctagttgaaaagtccagaattttggtaaatttatgttaacattttgccatatca |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5012623 |
gacaatcttctagctagttgaaaagtccagaattttggtaaatttatgttaacattttgccatatca |
5012689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University