View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_249 (Length: 288)
Name: NF11453A_low_249
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_249 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 133 - 275
Target Start/End: Complemental strand, 30402858 - 30402716
Alignment:
| Q |
133 |
aaacaagaacgaaatctggatatgtattttctcatacctgtgaatctccttcaacgatttgtctatgcatgttctatgaaattcatgattgcaaggcaga |
232 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30402858 |
aaacaagaaggaaatctggatatctattttctcatacctgtgaatctccttcaaccatttgtctatgcatgttctatgaaattcatgattgcaaggcaga |
30402759 |
T |
|
| Q |
233 |
actcgcacgctgtctccatcattatactctacaaggcatatat |
275 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30402758 |
acacgcacgctgtctccatcattatactctacaaggcatatat |
30402716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 165 - 275
Target Start/End: Original strand, 10783967 - 10784077
Alignment:
| Q |
165 |
catacctgtgaatctccttcaacgatttgtctatgcatgttctatgaaattcatgattgcaaggcagaactcgcacgctgtctccatcattatactctac |
264 |
Q |
| |
|
|||||||||||| ||| |||| | | |||||||| |||||| ||||||||||||||| ||||| || ||||||| |||||||||||| | ||||| || |
|
|
| T |
10783967 |
catacctgtgaacctctttcagccacttgtctatacatgttgtatgaaattcatgatgacaaggaagtactcgcatgctgtctccatcttcgtactccac |
10784066 |
T |
|
| Q |
265 |
aaggcatatat |
275 |
Q |
| |
|
||||||||||| |
|
|
| T |
10784067 |
aaggcatatat |
10784077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University