View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_270 (Length: 281)
Name: NF11453A_low_270
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_270 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 4 - 264
Target Start/End: Complemental strand, 37975578 - 37975318
Alignment:
| Q |
4 |
gcttagattagattctgtgatttattaggcacattacaaagttgacnnnnnnnnnnnnnnnnnnnnnntagggactggtggaataattggtgcttaagtt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37975578 |
gcttagattagattctgtgatttattaggcacattacaaagttgacaaaagaaaagaaaaaagaagaatagggactggtggaataattggtgcttaagtt |
37975479 |
T |
 |
| Q |
104 |
cgaagaaaacttattatttctctctctgtctttttgattttgtaatgtaggatagatgaagaaatgttactatgtttttgttagttagtgaaaatgaaac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37975478 |
cgaagaaaacttattatttctctctctgtctttttgattttgtaatgtaggatagatgaagaaatgttactatgtttttgttagttagtgaaaatgaaac |
37975379 |
T |
 |
| Q |
204 |
ataacattgtgtttagggaatctatattggttgaataaagagttggaatccactcaaaatt |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37975378 |
ataacattgtgtttagggaatctatattggttgaataaagagttggaatccactcaaaatt |
37975318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University