View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_275 (Length: 279)
Name: NF11453A_low_275
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_275 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 14 - 267
Target Start/End: Original strand, 11364875 - 11365128
Alignment:
| Q |
14 |
cgaatctaaaggtttctctgcctggattaatcagatgcttgtcacatcttgttaagaatgatgtagaaaatgatttgcttgacaaggtatatcttgtact |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11364875 |
cgaatctaaaggtttctctgcctggattaatcagatgcttgtcacatcttgttaagaatgatgtagaaaatgatttgcttgacaaggtatatcttgtact |
11364974 |
T |
 |
| Q |
114 |
ctattaacatttaattttggtgagtttttgttacctgaaacaacagtacattggtcattctttttaaactgctaaatatctttgcatcacataaacatat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11364975 |
ctattaacatttaattttggtgagtttttgttacctgaaacaacagtagattggtcattctttttaaactgctgcatatctttgcatcacataaacatat |
11365074 |
T |
 |
| Q |
214 |
tttacatcttagcattgtcatttcatttcccctttgcaactttaggttaatatt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11365075 |
tttacatcttagcattgtcatttcatttcccctttgcaactttaggttaatatt |
11365128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University