View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_289 (Length: 274)
Name: NF11453A_low_289
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_289 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 3 - 143
Target Start/End: Original strand, 41224281 - 41224421
Alignment:
| Q |
3 |
aaaagaaaaaattacgatcctctctcatgctgnnnnnnntgtgagaaaatgatgtggaatatctagatgattgaaatatagaggggaaggttttgaaatt |
102 |
Q |
| |
|
|||||||||||| | ||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41224281 |
aaaagaaaaaatcatgatcctctctcatgctgaaaaaaatgtgagaaaaaaatgtggaatatctagatgattgaaatatagaggggaaggttttgaaatt |
41224380 |
T |
|
| Q |
103 |
tgaaataataaaggagaaacactagttaaggattgagattt |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41224381 |
tgaaataataaaggagaaacactagttaaggattgagattt |
41224421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 135 - 262
Target Start/End: Original strand, 41224447 - 41224574
Alignment:
| Q |
135 |
ttgagatttgaaacttgagaaaataggaggagaaatagcgatgattcacttcttgttgttgggcacaaatggagtgatggtaannnnnnngcttacctag |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41224447 |
ttgagatttgaaacttgagaaaataggaggagaaatagcgacgattcacttcttgttgttgggcacaaatggagtgatggtaatttttttgcttacctag |
41224546 |
T |
|
| Q |
235 |
ttaatttatttgatatcatcataatttt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
41224547 |
ttaatttatttgatatcatcataatttt |
41224574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University