View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_294 (Length: 272)
Name: NF11453A_low_294
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_294 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 4 - 266
Target Start/End: Complemental strand, 6601036 - 6600774
Alignment:
| Q |
4 |
tggtgttcttgcgggacagcagggtcaaataaggagaaattgtagggctgttaactaaaaacctacatatgtgattttaaaaaatttagtaatgtatttg |
103 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6601036 |
tggtattcttgcgggacagcagggtcaaataaggaaaaattgtagggctgttaactaaaaacctacatatgtgattttaaaaaatttagtaatgtatttg |
6600937 |
T |
|
| Q |
104 |
tatgaaactgggcttgcctcaaataatgatataaatgtgtgtttagtattttattggtttgttcgtgtttggaaaatttaggtggtactataataatatt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6600936 |
tatgaaactgggcttgcctcaaataatgatataaatgtgtgtttagtattttattggtttgttcgtgtttggaaaatttaggtgatactataataatatt |
6600837 |
T |
|
| Q |
204 |
gtatagaagtaaaatcctatttggtccattgatgtactacatgttcttcactattgtggataa |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6600836 |
gtatagaagtaaaatcctatttggtccattgatgtactacatgttcttcactattgtggataa |
6600774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 15 - 60
Target Start/End: Complemental strand, 6608438 - 6608393
Alignment:
| Q |
15 |
cgggacagcagggtcaaataaggagaaattgtagggctgttaacta |
60 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
6608438 |
cgggacaacagggtcaaataaggaaaaattgtagggttgttaacta |
6608393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University