View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_312 (Length: 266)
Name: NF11453A_low_312
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_312 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 6 - 254
Target Start/End: Original strand, 15694955 - 15695203
Alignment:
| Q |
6 |
atatatagtatgaaagcaaaaaatattgatgtcaagtttagttttcttccttccatggagtactatgttcctattgcatgattccaattattgccaatga |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15694955 |
atatatagtatgaaagcaaaaaatattgatctcaagtttagttttcttccttccatggagtactatgttcctattgcatgattccaattattgccaatga |
15695054 |
T |
|
| Q |
106 |
tgttgtaatgataattgagctattatatttagaagtccaaagcaaatgatgctgtaatgatagaaaatttgagtcatgaatttatgtttaccaagtccac |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15695055 |
tgttgtaatgataattgagctattatatttagaagtccaaagcaaatgatgctgtaatgatagaaaatttgagtcatgaatttatgtttaccaagtccac |
15695154 |
T |
|
| Q |
206 |
tcttcatgtgtttgtattgatagatattttagaaaagtcaaaggatatt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15695155 |
tcttcatgtgtttgtattgatagatattttagaaaagtcaaaggatatt |
15695203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University