View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_322 (Length: 263)
Name: NF11453A_low_322
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_322 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 9538963 - 9539217
Alignment:
| Q |
1 |
gatacaatgttcatatcaactgagttaagctttcgaggacatcacatgcatcagcttatagttgcagattcttctcacacaaatttttcagtgatatatc |
100 |
Q |
| |
|
|||||| |||| ||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9538963 |
gatacattgtttataccaactgagttaagctttcgaggacatcacatgcatcagtttatagttgcagattcttctcacacaaatttttcaatgatatatc |
9539062 |
T |
|
| Q |
101 |
aatgttgttggaacattgttcaattatttaaattatgaactaagttcaaatatgattttttaaatatacta-nnnnnnnnaactcatgcataagattaga |
199 |
Q |
| |
|
||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9539063 |
aattttgttggaacattgttgaattatttaaattatgaactaagttcaaatatgattttttaaatatactatttttttttaactcatgcataagattaga |
9539162 |
T |
|
| Q |
200 |
aactcacatttagatttccttgtgttannnnnnncatttcaagtgtcatattctt |
254 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
9539163 |
aactcacatttagatttccttgtgttatttttttcatttcaagtgtcattttctt |
9539217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 42
Target Start/End: Complemental strand, 2445325 - 2445291
Alignment:
| Q |
8 |
tgttcatatcaactgagttaagctttcgaggacat |
42 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2445325 |
tgttcatatcaactgagttaagcttacgaggacat |
2445291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University