View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_323 (Length: 263)
Name: NF11453A_low_323
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_323 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 120 - 257
Target Start/End: Original strand, 5251279 - 5251406
Alignment:
| Q |
120 |
ataagaatagtggttaagcactagagcgatgatgaagcgaaggaaatgaaagataagtgtataatgcaaacaattttaacaaacaggttcatccatgata |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5251279 |
ataagaatagtggttaagcactagagcgatgatgaagcgaaggaaatgaaa----------taatgcaaacaattttaacaaacaggttcatccatgata |
5251368 |
T |
 |
| Q |
220 |
attttaaaacaatcgnnnnnnntatacaaaggaatgaa |
257 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |
|
|
| T |
5251369 |
attttaaaacaatcgaaaaaaatatacaaaggaatgaa |
5251406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 7 - 96
Target Start/End: Original strand, 5251170 - 5251259
Alignment:
| Q |
7 |
tttggtgttgatgttggattttatatataaaatgtttctttgctgaaagcacaaaaaacaagtgttacagcataaaaatagtggtttttg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
5251170 |
tttggtgttgatgttggattttatatataaaatgtttctttgcagaaagcacaaaaaacaagtgttacaacataagaatagtggtttttg |
5251259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University