View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_329 (Length: 262)
Name: NF11453A_low_329
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_329 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 7 - 253
Target Start/End: Complemental strand, 43953856 - 43953610
Alignment:
| Q |
7 |
agcctcactgttggagacatctttgctagtctccttgcctttttgccaacagcatgggcaattataatggtacttgtttattaaccaccaccttttgttg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953856 |
agcctcactgttggagacatctttgctagtctccttgcctttttgccaacagcatgggcaattataatggtacttgtttattaaccaccaccttttgttg |
43953757 |
T |
|
| Q |
107 |
gatagatatgtctcattggatccatccgaatatgcacttgtttgtgtccaacacaatttgacttaagttagtccgtccatgaatttctcttggcacttgt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953756 |
gatagatatgtctcattggatccatccgaatatgcacttgtttgtgtccaacacaatttgacttaagttagtccgtccatgaatttctcttggcacttgt |
43953657 |
T |
|
| Q |
207 |
ctagtagccgctgccattaaaccacactcaggcttgaccatattctt |
253 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
43953656 |
ttagtagccgccgccattaaaccacattcaggcttgaccatattctt |
43953610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University