View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_335 (Length: 261)
Name: NF11453A_low_335
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_335 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 2 - 252
Target Start/End: Original strand, 33063877 - 33064125
Alignment:
| Q |
2 |
caaatgagttttagctcgggacggactaactcttataatcattgacaatggccttctttttatnnnnnnnnnntgctaatatttgaccatactatatact |
101 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
33063877 |
caaatgagttttagctcgggacggactgactcttataatcattgacaatggccttctttttattaaaaaaa--tgctaatatttgacaatactatatact |
33063974 |
T |
|
| Q |
102 |
ctcagtctttctgatgcatgatgatggttatctataccgttttctaaaaacataacatattaaatcattcattctaactgaactgatcttgtacaacagt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33063975 |
ctcagtctttctgatgcatgatgatggttatctataccgttttctaaaaacataacatattaaatcattcattctaactgaactgatcttgtacaacagt |
33064074 |
T |
|
| Q |
202 |
tgatcaaataaatgtccgttaaatactgttcatactgggcatgatattgtt |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33064075 |
tgatcaaataaatgtccgttaaatactgttcatactgggcatgatattgtt |
33064125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University