View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_343 (Length: 258)
Name: NF11453A_low_343
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_343 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 89 - 250
Target Start/End: Complemental strand, 51232251 - 51232090
Alignment:
| Q |
89 |
attctaatgatgatggtattaatttatcttgcattcttgttgtagcttaaacaactaagcaacgaagttataaggagggaacaacgatttgatgatcata |
188 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51232251 |
attctaacgatgatggtattaatttatcttgcattcttgttgtagcttaaacaactaaccaacgaagttataaggagggaacaacgatttgatgatcata |
51232152 |
T |
 |
| Q |
189 |
gctgagaccacgaataatgtttaatgtctcttacaagcctagaaatgttcttttgatgtcca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51232151 |
gctgagaccacgaataatgtttaatgtctcttacaagcctagaaatgttcttttgatgtcca |
51232090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University