View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_347 (Length: 257)
Name: NF11453A_low_347
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_347 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 5 - 156
Target Start/End: Original strand, 25933262 - 25933416
Alignment:
| Q |
5 |
aatatccgtctcatagtcaaggagatggaataatgtttgattgttgtcgtttttattaaactaagttgaacgccctttctctaaaaatcagaaagttaac |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25933262 |
aatatccgtctcatagtcaaggagatggaataatgtttgattgttgtcgtttttattaaactaagttgaacgccctttctctgaaaatcagaaagttaac |
25933361 |
T |
|
| Q |
105 |
atcaaaacacaataat---ggtttgttcttgaaaaatgattaatttaacatacaa |
156 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25933362 |
atcaaaatacaataattacggtttgttcttgaaaaatgattaatttaacatacaa |
25933416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 225 - 257
Target Start/End: Original strand, 25933485 - 25933517
Alignment:
| Q |
225 |
acaaatctttgaacaaccatgcataaagttatt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
25933485 |
acaaatctttgaacaaccatgcataaagttatt |
25933517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University