View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_348 (Length: 256)
Name: NF11453A_low_348
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_348 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 12 - 256
Target Start/End: Original strand, 13274915 - 13275159
Alignment:
| Q |
12 |
aagaagaaagtcaagttaactactcgaatttaatacaacttttttgctcttatttgctataaacgtgatagccttaacaagctcctcctctaccatgaat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13274915 |
aagaagaaagtcaagttaactactcgaatttaatacaacttttttgctcttatttgctataactgtgatagccttaacaagctcctcctttaccatgaat |
13275014 |
T |
|
| Q |
112 |
aatacagaagcagcaaaaacactctgtactatctttgtgctcatccctttataaaagcctgggaatccttcataacggatcattttgagaattgcatcaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13275015 |
aatacagaagcagcaaaaacactctgtactatctttgtgctcatccctttataaaagcctgggaatccttcataacggatcattttgagaattgcatcaa |
13275114 |
T |
|
| Q |
212 |
atgtacctgcattataagaaaaatatagttgtcgaaaaatatgca |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13275115 |
atgtacctgcattataagaaaaatatagttgtagaaaaatatgca |
13275159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University