View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_358 (Length: 252)
Name: NF11453A_low_358
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_358 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 2 - 153
Target Start/End: Complemental strand, 38528741 - 38528590
Alignment:
| Q |
2 |
atatcacccacttttatcattctctaatttgacacaatattctttctttctgcgtctcttcaaacaggtatgttcttattcatgaatcatgaccatttca |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38528741 |
atatcacccacttttatcattctctaatttgacacaatattccttttttctgcgtctcttcaaacaggtatgttcttattcattaatcatgaccatttca |
38528642 |
T |
 |
| Q |
102 |
atatgtatatannnnnnnaatctcttatggattcaagttctataaagttggt |
153 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
38528641 |
atatgtatatatttctttaatctctcatggattcaagttctataaagttggt |
38528590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University