View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_359 (Length: 252)
Name: NF11453A_low_359
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_359 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 7 - 245
Target Start/End: Complemental strand, 31503179 - 31502941
Alignment:
| Q |
7 |
acacagacccggtcaaaggtagagtttgatttacaatgatatgagaagctgccttgaatctagattatgtaacacatggctaatgaatttggtagcaaaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31503179 |
acacagacccggtcaaaggtagagtttgatttacaatgatatgagaagctgccttgaatctagattatgtaacacatggctaatgaatttggtagcaaaa |
31503080 |
T |
|
| Q |
107 |
ggaaaaaatttaataccaaccgtacctggcttaaaagatacccatccaaacatataaataaaaaatagaaggaacatatacgaagaaccaattatacatt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
31503079 |
ggaaaaaatttaataccaaccgtacctggcttaaaagttacccatccaaacatataaataaaaaatagaaggaacatatccgatgaaccaattatacatt |
31502980 |
T |
|
| Q |
207 |
gatacatacataaaagaatcagagattccatgtgagtgg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31502979 |
gatacatacataaaagaatcagagattccatgtgagtgg |
31502941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University