View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_362 (Length: 251)
Name: NF11453A_low_362
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_362 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 99 - 215
Target Start/End: Original strand, 11626711 - 11626839
Alignment:
| Q |
99 |
gtgtttagtggaattttgggtaacgtggtggaagttgattggtcatgttgtgaatgacagcgttcaaggagacaatgttg------------ttaccata |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11626711 |
gtgtttagtggaattttgggtaacgtggtggaagttgattggtcatgttgtgaatgacagcgttcaaggagacaatgttgtttcgattttttttaccata |
11626810 |
T |
|
| Q |
187 |
aaagataggaaaagaaggggtagaaatag |
215 |
Q |
| |
|
|||||||||||||| |||||||||||||| |
|
|
| T |
11626811 |
aaagataggaaaaggaggggtagaaatag |
11626839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 11626610 - 11626680
Alignment:
| Q |
1 |
gtggtttttcagattctctagttaca-tataactttttgtgtaccctacttgtggcaa-tgacacgtcaac |
69 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11626610 |
gtggtttttcagattctctagttacaatataactttttgtgtaccctacttgtggcaattgacacgtcaac |
11626680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University