View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_368 (Length: 250)
Name: NF11453A_low_368
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_368 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 4 - 250
Target Start/End: Complemental strand, 2727942 - 2727694
Alignment:
| Q |
4 |
gactttggtgtttatcctatggatacaaattggggagttgcattgcttgatcttttgggaaatttggcatttcctttgatattgcttggtactttactcc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2727942 |
gactttggtgtttatcctatggatacaaattggggagttgcaatacttgatcttttgggaaatttggcatttcctttgatattgcttggtactttactcc |
2727843 |
T |
|
| Q |
104 |
ttaggacatctagaaataattctgttggtggccctaacttgccatttggattaggaaggtatgaattgtagcacgtgaaacttcc--ataactataagga |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2727842 |
ttaggacatctagaaataattctgttggtggccctaacttgccatttggattaggaaggtatgaattgtagcacgtgaaacttccatataactataagga |
2727743 |
T |
|
| Q |
202 |
tctaattccgtatatgcaccgatagtgtaaagattttttatactgtcag |
250 |
Q |
| |
|
| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2727742 |
tttaattccgtatatgcaccgacagtgtaaagattttttatactgtcag |
2727694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University