View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_383 (Length: 249)
Name: NF11453A_low_383
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_383 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 17 - 249
Target Start/End: Original strand, 55341336 - 55341568
Alignment:
| Q |
17 |
gacatcataattcatttactaggagcttttttatgcagcagcttctcaactttgagcacagtggttagcatcaaaaagacaaaaaccagaacagacacaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55341336 |
gacatcataattcatttactaggagcttttttatgcagcagcttctcaactttgagcacagtggttagcatcaaaaagacaaaaaccagaacagacacaa |
55341435 |
T |
 |
| Q |
117 |
tacatatcaccagcattaaagcagaggccatactacttttcacctcatgagcatattcagcacaagctaaaccaaggaatgttaaagggaatgagtaaat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55341436 |
tacatatcaccagcattaaagcagaggccatactacttttcacctcatgagcatattcagcacaagctaaaccaaggaatgttaaagggaatgagtaaat |
55341535 |
T |
 |
| Q |
217 |
ccaccatgtaacgtttaaccttctcatagtttt |
249 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
55341536 |
ccaccatgtaacgtttaaccttttcatagtttt |
55341568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University