View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_395 (Length: 248)
Name: NF11453A_low_395
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_395 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 6 - 248
Target Start/End: Complemental strand, 35450052 - 35449810
Alignment:
| Q |
6 |
tttggtgttagtacttcaatcattgattgatcaataattggtgaagaaacaatgctttcttcacaatctgatgaagacaaagaaaaaccattgtttgagt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35450052 |
tttggtgttagtacttcaatcattgattgatcaataattggtgaagaaacaatgctttcttcacaatctgaagaagacaaagaaaaaccattgtttgagt |
35449953 |
T |
|
| Q |
106 |
caattccttttcttgtaacttgttcatcttcaatgcttgaaactccggaaagtggagcattttgttgttgatggacaactagcttttccaagagaagtct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35449952 |
caattccttttcttgtaacttgttcatcttcaatgcttgaaactccggaaagtggatcattttgttgttgatggaaaactagcttttccaagagaagtct |
35449853 |
T |
|
| Q |
206 |
ttcacatttttcttgtgcttcatctctttctctaatgatgttg |
248 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35449852 |
ttgacatttttcttgtgcttcatctctttctctaatgatgttg |
35449810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 170 - 238
Target Start/End: Original strand, 21010633 - 21010701
Alignment:
| Q |
170 |
ttgttgatggacaactagcttttccaagagaagtctttcacatttttcttgtgcttcatctctttctct |
238 |
Q |
| |
|
|||||| |||| || || |||||| |||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
21010633 |
ttgttgttggaaaagtaacttttctaagaaaagtctttggcatttttcttgtgcttcatctctttctct |
21010701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University