View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_398 (Length: 248)
Name: NF11453A_low_398
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_398 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 8 - 243
Target Start/End: Original strand, 18260089 - 18260325
Alignment:
| Q |
8 |
tggtgttagcatctggagttttagggatcaagataagagagtttgcactgtagttgggaaggagcgatccagtcttgaagaattctaccacagcttcata |
107 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18260089 |
tggtgtcagcatatggagttttagggatcaagataagagagtttgcattgtagttgggaaggagccatccagtcttgaagaattctaccacagcttcata |
18260188 |
T |
|
| Q |
108 |
cacatctttctgaactatatcccaataggtttggaaaaagcaagcaccaaa-ccatgaggccctggtgcaccatcatgattcaaataaaaaatagcattt |
206 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18260189 |
cacatctttcttaactatattccaataggtttggaaaaagcaagcaccaaacccatgaggccctggtgcaccatcatgattcaaataaaaaatagcattt |
18260288 |
T |
|
| Q |
207 |
ttaacttcacttggattgggaatattagtgggaatct |
243 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18260289 |
ttaacttcacttggattaggaatattagtgggaatct |
18260325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University