View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_406 (Length: 247)
Name: NF11453A_low_406
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_406 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 9 - 220
Target Start/End: Original strand, 4401114 - 4401326
Alignment:
| Q |
9 |
gaacaatattatgttcttttttatatagtttaatgttatttgaaaggcggcaagaagcaacttgacagttggtgtattcagtttttt-cttcatacatat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4401114 |
gaacaatattatgttcttttttatatagtttaatgttatttgaaaggcggcaagaagcaacttgacagttggtgtattcagttttttccttcatacatat |
4401213 |
T |
 |
| Q |
108 |
aatataatcatactacagctcataactttatttcggctttggcataatgttactcnnnnnnnnnnnnnaatatttggtaaatgcatacaaattaaagaaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4401214 |
aatataatcatactacagctcataactttatttcggctttggcataatgttactcttttttgttttttaatatttggtaaatgcatacaaattaaagaaa |
4401313 |
T |
 |
| Q |
208 |
cacttaactgata |
220 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
4401314 |
cacttaattgata |
4401326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University