View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_407 (Length: 247)
Name: NF11453A_low_407
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_407 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 49563496 - 49563286
Alignment:
| Q |
18 |
catcatgtaaaggattgaaagaaccaggcagtattattttcctttctgctggtatctctgaaaccagagaataaaaaattatcaataacaaagtaaatcg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49563496 |
catcatgtaaaggattgaaagaaccaggcagtattattttcctttctgctggtatctctgaaaccagagaataaaaaattatcaataacaaagtaaatcg |
49563397 |
T |
|
| Q |
118 |
tcattgtaactgtaataatattgcttctgcacaaaggtttaactataccacttctaaatggataaatcttgaagcatatttgaccatttataagttgcca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49563396 |
tcattgtaactgtaataatattgcttctgcacaaaggtttaactataccacttctaaatggataaatcttgaagcatatttgaccatttataagttgctc |
49563297 |
T |
|
| Q |
218 |
taactcttgat |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
49563296 |
taactcttgat |
49563286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University