View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_408 (Length: 247)
Name: NF11453A_low_408
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_408 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 2281998 - 2281765
Alignment:
| Q |
1 |
ttgatcatgtttatagagaaaaagagtggttatgtagttaaatttatgcatcatccatgcatctaacctccaaccctccttaaatcattttattaagttt |
100 |
Q |
| |
|
||||||| ||| ||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
2281998 |
ttgatcaagttgatagagaaaaagattggttagttagttaaatttatgcatcatccatgcatctaacctcgaaccctccttaaatcattttatcaagttt |
2281899 |
T |
|
| Q |
101 |
aatttagtactattaatactcaattcataactattcaattgatagaaataatttttatnnnnnnnnnngtgagagaaatatcaatgttcttcgataagtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2281898 |
aatttagtactattaatactcaattcataactattcaattgatagaaataatgtttat-aaaaaaaaagtgagagaaatatcaatgttcttcgataagtg |
2281800 |
T |
|
| Q |
201 |
gtggaggtagtttaatttttagggataaacatatt |
235 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
2281799 |
gtggaggtagtttaatttttagggttaaacatatt |
2281765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University