View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_410 (Length: 247)
Name: NF11453A_low_410
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_410 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 2 - 247
Target Start/End: Complemental strand, 12122859 - 12122614
Alignment:
| Q |
2 |
agtttggtgttattggttttatggattctgtctaaagtaatcttcattatgtccctctattttgatagtctgtcctctatctcacgtgtttcccctctcc |
101 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12122859 |
agttcggtgttattggttttatggattctgtctaaagtaatcttcattatgtctctctattttgatagtctgtcctctatctcacgtgtttcccctctcc |
12122760 |
T |
|
| Q |
102 |
cagcttatcattttctggtttttctcttcccttttcatataattcttgatttcatatgtttaatagcttttttgacaatttttattgttatttgtgttct |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12122759 |
cagcttatcattttctggtttttctcttcccttttcatataattcttgatttcatatgtttaatagcttttttgacaatttttattgttatttgtgttca |
12122660 |
T |
|
| Q |
202 |
atagatacagcatctgtacaatcatggtgaagctgcaaatcacgga |
247 |
Q |
| |
|
||||||||||| || ||| | |||||||||||| ||||| |||| |
|
|
| T |
12122659 |
atagatacagcttcagtagcaaaatggtgaagctgaaaatcccgga |
12122614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 170 - 242
Target Start/End: Complemental strand, 14692210 - 14692138
Alignment:
| Q |
170 |
tttttgacaatttttattgttatttgtgttctatagatacagcatctgtacaatcatggtgaagctgcaaatc |
242 |
Q |
| |
|
||||||||||||||| ||||||||||||||| || |||||||| || ||| | |||||||||||| ||||| |
|
|
| T |
14692210 |
tttttgacaatttttgttgttatttgtgttcaatggatacagcttcagtaacaaaatggtgaagctgaaaatc |
14692138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University