View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_413 (Length: 246)
Name: NF11453A_low_413
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_413 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 177 - 246
Target Start/End: Original strand, 50636491 - 50636560
Alignment:
| Q |
177 |
gatgttaaggctaagtgcatgtttcttatcacgattaaatcattgaaatcacggtaaaccactttgatta |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50636491 |
gatgttaaggctaagtgcatgtttcttatcacgattaaatcattgaaatcacggtaaaccactttgatta |
50636560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 5 - 68
Target Start/End: Original strand, 50636320 - 50636382
Alignment:
| Q |
5 |
actgagatgaaaattgtgcaaatgataagtgtttatagattgtgatgagcaataaatagcgtag |
68 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
50636320 |
actgaaatgaaaattgtgcaaatgata-gtgtttatagattgtgatgagcaataaatagcgtag |
50636382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University