View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_428 (Length: 244)
Name: NF11453A_low_428
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_428 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 13308655 - 13308877
Alignment:
| Q |
19 |
ctgagtgtaatagtaaaatgttgtgccatgactgacatggattttggcaattagtgatgccaaaagagaagagaatgagataactcgaaaagcgagcaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
13308655 |
ctgagtgtaatagtaaaatgttgtgccatgactgacatggattttggcaattagtgatgccaaaagagaagagaatgagataactcgaaaaactagcaaa |
13308754 |
T |
|
| Q |
119 |
caaacagggtgaatgtccttaaggcatggcttccacgcttcatcgccacacaaagtactctgattttctccgttgtcaaatgtgagatttcttgaacttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13308755 |
caaacagggtgaatgtccttaaggcatggcttccacgcttcatcgccacacaaagtactctggttttctccgttgtcaaatgtgagattccttgaacttt |
13308854 |
T |
|
| Q |
219 |
cacgcttccatattgttcgacat |
241 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
13308855 |
cacgcttccatattgttagacat |
13308877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University