View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_429 (Length: 244)
Name: NF11453A_low_429
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_429 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 23 - 244
Target Start/End: Complemental strand, 5013086 - 5012865
Alignment:
| Q |
23 |
aaaatcaagtacttatcactgaaccgacctctcttagatataacaattgattttcattagattaaaaaataaagtaaaattcattaattttcttatggag |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5013086 |
aaaatcaagtacttatcactgaaccgacctctcttagatataacaattgattttcattagattaaaaaataaagtaaaattcattaattttcttatggag |
5012987 |
T |
 |
| Q |
123 |
tatgatgtgatttaagctttgtttattatatacgagattggatagaacagaacatatttataattgtataatcataatttttctttctttcaataccttc |
222 |
Q |
| |
|
| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5012986 |
tgtgatgtgattttagctttgtttattatatacgagattggatagaacagaacatatttataattgtataatcataatttttctttctttcaataccttc |
5012887 |
T |
 |
| Q |
223 |
caaagcttcaaacaaacagtgg |
244 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
5012886 |
caaagcttcaaacaaacagtgg |
5012865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University