View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_437 (Length: 244)
Name: NF11453A_low_437
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_437 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 7 - 231
Target Start/End: Original strand, 44650836 - 44651059
Alignment:
| Q |
7 |
tttggtgttggctgaaaatacaagcatgaaaataataagcaagaaaggcaatgaattagccatatgattttgagttgggaattgtttgttgagaggaagg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44650836 |
tttggtgttggctgaaaatacaagcatgaaaataataagcaagaaaggcaatgaattagccatatgattttgagttgggaattgtttgttgagagcaagg |
44650935 |
T |
 |
| Q |
107 |
ggataaactagctagctaggtggaactaaagcaaaaataaatactagttattattatgtcacaaaattaaggttttggattgggatttttatagcgatat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44650936 |
ggataaactagctagctaggtggaactaaatcaaaaataaatactagttattattatgtcac-aaattaaggttttggattgggatttttatagcgatat |
44651034 |
T |
 |
| Q |
207 |
gcacgtttataagcgtggcaatata |
231 |
Q |
| |
|
||||||||||||| ||||||||||| |
|
|
| T |
44651035 |
gcacgtttataagagtggcaatata |
44651059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University