View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_439 (Length: 243)
Name: NF11453A_low_439
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_439 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 21 - 117
Target Start/End: Complemental strand, 6097131 - 6097035
Alignment:
| Q |
21 |
taaacattacaggataagttttacgagttataagacaattcccgcgtcatgacttcatgacttagggaatttattagaatagaaaggaataacccaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6097131 |
taaacattacaggataagttttacgagttataagacaattcccgcgtcatgacttcatgacttagggaatttattagaatagaaaggaataacccaa |
6097035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 114 - 243
Target Start/End: Complemental strand, 6096864 - 6096737
Alignment:
| Q |
114 |
ccaaggtgtgggcactaggagttatgtggatttttgaatgaacnnnnnnnnngtcgatgttggtttttgcttgtgagtactgattgtttgtttatagtag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6096864 |
ccaaggtgtgggcactaggagttatgtggatttttgaatgaactttttctt-gttgatgttggtttttgcttgtgagtactgattgtttgtttatagtag |
6096766 |
T |
|
| Q |
214 |
atgcttttaattcgaacaattcttcatttg |
243 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |
|
|
| T |
6096765 |
atgc-tttaattcgaacaattcttcatttg |
6096737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 40 - 117
Target Start/End: Complemental strand, 27766451 - 27766374
Alignment:
| Q |
40 |
tttacgagttataagacaattcccgcgtcatgacttcatgacttagggaatttattagaatagaaaggaataacccaa |
117 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27766451 |
tttacgagtcataagacaattcccgcgtcatgacttcatgacttagggaattttttagaatagaaaggaataacccaa |
27766374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University