View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_441 (Length: 243)
Name: NF11453A_low_441
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_441 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 3990863 - 3991085
Alignment:
| Q |
1 |
tagcggaattagcaacaatctatcccaacgtgaaaattctccactttcatgtcgaattaaaaaacaaccatttggagttcaaggtagtatctctgttttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3990863 |
tagcggaattagcaacaatctatcccaacgtgaaaattctccactttcatgtcgaattaaaaaacaaccatttggagttcaaggtagtatctctgttttt |
3990962 |
T |
|
| Q |
101 |
tctcttgcattggatgactatctgcaaactaatattcttctttacttagtttcaacttaaggaaggaccgaaacatatcccccattatggccttctctta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3990963 |
tctcttgcattggatgactatctgcaaactaatattcttctttacttagtttcaacttaaggaaggaccgaaacatatcccccattatggccttctctta |
3991062 |
T |
|
| Q |
201 |
gcagaagttgcaggattaccaac |
223 |
Q |
| |
|
|||||||| |||||||||||||| |
|
|
| T |
3991063 |
gcagaagtggcaggattaccaac |
3991085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 149 - 224
Target Start/End: Complemental strand, 17936062 - 17935987
Alignment:
| Q |
149 |
gtttcaacttaaggaaggaccgaaacatatcccccattatggccttctcttagcagaagttgcaggattaccaact |
224 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
17936062 |
gtttcaacttaaggagtgaccgaaacatagcccccattatggccttctcttcgcataagtgaaaggattaccaact |
17935987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University