View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_457 (Length: 242)
Name: NF11453A_low_457
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_457 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 20 - 198
Target Start/End: Original strand, 45362574 - 45362752
Alignment:
| Q |
20 |
gaattaccctgcgccaaaccccgaaatgttctctccaaaaaacgttgctgctgctaagaaaacgaaggatcttgatatgnnnnnnnggagttcaagtgat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| ||||| |||||||||||||| |
|
|
| T |
45362574 |
gaattaccctgcgccaaaccccgaaatgttctctccaaaaaacgttgttgctgctaagaaaacggaggatcttcatatgtttttttggagttcaagtgat |
45362673 |
T |
|
| Q |
120 |
tcccttgtttctgatgttaaattgaatgtctctccagaaaaaggtttcttttaattattttttactaatagttgtttgc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45362674 |
tcccttgtttctgatgttaaattgaatgtctctccagaaaaaggtttcttttaattattttttactaatagttgtttgc |
45362752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University