View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_469 (Length: 241)
Name: NF11453A_low_469
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_469 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 39 - 222
Target Start/End: Original strand, 33649868 - 33650050
Alignment:
| Q |
39 |
aatatttggatatgagattgatagatccaaatttcaatacatgatttgattatttaaagnnnnnnnnnnnctaaaataccgagtttaaaatcgttagcgt |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33649868 |
aatatttggatatgagattgatagatccaaatttcaatacatgatttgattatttaaagaaaaaaaaaa-ctaaaataccgagtttaaaatcgttagcgt |
33649966 |
T |
|
| Q |
139 |
ccgattttgatccaacggttaaatttcatatcttggtgggtctgacaatgactacttcaattttaagctctaaatgcatcttcc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33649967 |
ccgattttgatccaacggttaaatttcatatcttggtgggtctaacaatgactacttcaattttaagctctaattgcatcttcc |
33650050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University