View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_472 (Length: 241)
Name: NF11453A_low_472
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_472 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 13 - 224
Target Start/End: Complemental strand, 42744070 - 42743859
Alignment:
| Q |
13 |
atgaagggaacacagagtggtttacacagaacactggctttatgtttgagcaagcaccttatttcaatgcccttttggtttttattgaggtaaactttat |
112 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42744070 |
atgaagggaacatagagtggtttacacaaaacactggctttatgtttgagcaagcaccttatttcaatgcccttttggtttttattgaggtaaactttat |
42743971 |
T |
|
| Q |
113 |
tgtcttggattctctacctcttctgcattgtctttttgtctcatatcctagaaaacattttagtacatgtctggattaacggtgaaattgacaacaaaat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42743970 |
tgtcttggattctctacctcttctgcattgtctttttgtctcatatcctagacaacattttagtacatgtctggattaacgttgaaattgacaacaaaat |
42743871 |
T |
|
| Q |
213 |
cgcagttgattt |
224 |
Q |
| |
|
|||||||||||| |
|
|
| T |
42743870 |
cgcagttgattt |
42743859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 37 - 103
Target Start/End: Complemental strand, 42748770 - 42748704
Alignment:
| Q |
37 |
cacagaacactggctttatgtttgagcaagcaccttatttcaatgcccttttggtttttattgaggt |
103 |
Q |
| |
|
|||| ||||||||||||||||| || |||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
42748770 |
cacaaaacactggctttatgttcgaaatagcaccctatttcaatgccattttggtttttattgaggt |
42748704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University