View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_473 (Length: 241)
Name: NF11453A_low_473
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_473 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 34 - 228
Target Start/End: Original strand, 44611417 - 44611611
Alignment:
| Q |
34 |
tgcgaagaatatgtttgttgaatataaagataaaatggatatttcttaggtttagtggattataggttcagtgatttgtttctgctgctgttggttcgtg |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
44611417 |
tgcgaagaatatgtttgttgaatataaagataaaatgaatatttcttaggtttagtggattataggttcagtgatttgtttctgctgctgttggtttgtg |
44611516 |
T |
|
| Q |
134 |
ctctgctgtctttttggtcttgagatcttcctaggattttggcttctgatgctactatttttcaggtttacagctttcgatggcttcattttctt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44611517 |
ctctgctgtctttttggtcttgagatcttcctaggattttggcttctgatgctactgtttttcaggtttacagctttcgatggtttcattttctt |
44611611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 110 - 209
Target Start/End: Original strand, 13146114 - 13146213
Alignment:
| Q |
110 |
tgtttctgctgctgttggttcgtgctctgctgtctttttggtcttgagatcttcctaggattttggcttctgatgctactatttttcaggtttacagctt |
209 |
Q |
| |
|
||||| ||||||| |||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
13146114 |
tgtttatgctgctattggtttgtgctctgctgtctttttggtcttgagatcttcctagggttttggcttctgatgctattgtttttcaggtttacagctt |
13146213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 110 - 202
Target Start/End: Complemental strand, 26379661 - 26379569
Alignment:
| Q |
110 |
tgtttctgctgctgttggttcgtgctctgctgtctttttggtcttgagatcttcctaggattttggcttctgatgctactatttttcaggttt |
202 |
Q |
| |
|
||||||| ||| | |||||| |||||||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26379661 |
tgtttctactgttattggtttgtgctctgctgtttttttggtcttgagatctttctagggttttggcttctgatgctactatttttcaggttt |
26379569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 205
Target Start/End: Original strand, 22247022 - 22247058
Alignment:
| Q |
169 |
attttggcttctgatgctactatttttcaggtttaca |
205 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22247022 |
attttggcttttgatgctactatttttcaggtttaca |
22247058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University