View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_475 (Length: 241)
Name: NF11453A_low_475
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_475 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 209
Target Start/End: Complemental strand, 8231553 - 8231520
Alignment:
| Q |
176 |
atagagataaaatgaagatttggaccaccggttg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8231553 |
atagagataaaatgaagatttggaccaccggttg |
8231520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University