View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_477 (Length: 240)
Name: NF11453A_low_477
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_477 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 16 - 225
Target Start/End: Complemental strand, 27492130 - 27491921
Alignment:
| Q |
16 |
ataaatatcacacattaaaatataaatcactttataatcaatt-atttttaatggtactcaatttcaaaaagttaattcactcaaaacatttattatcac |
114 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||| | |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27492130 |
ataaatatcacacattaaaacataaatcacttcatattaaattcatttttaatcgtactcaatttcaaaaagttaattcactcaaaacatttattatcac |
27492031 |
T |
|
| Q |
115 |
tagaaaatgaagcacacatcactttaagcacaaccaattttacaaaatgaattcattnnnnnnnttggtttgtgtcacatacataaccaaacacacacat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27492030 |
tagaaaatgaagcacacatcactttaagcacaaccaattttacaaaatgaattcattaaaaaaattggtttgtgtcacatacat-accaaacacacacat |
27491932 |
T |
|
| Q |
215 |
gctcatattct |
225 |
Q |
| |
|
|||||| |||| |
|
|
| T |
27491931 |
gctcattttct |
27491921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University