View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_479 (Length: 240)
Name: NF11453A_low_479
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_479 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 30 - 193
Target Start/End: Original strand, 9457146 - 9457309
Alignment:
| Q |
30 |
tgtttactttatagatgatcattagattgtaataaaaatcacatatagccattttggaatacggtaataaaaacctcaacactcattttgttaccgatct |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9457146 |
tgtttactttatagatgatcattagattgtaataaaaatcacatatagccgttttggaatacggtaataaaaatctcaacactcattttgttaccgatct |
9457245 |
T |
|
| Q |
130 |
caagtttgtgttttgtgtaggggagagataaaatgtttataaattacaattaatcttgattttc |
193 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9457246 |
caagtttgtgttttgcgtaggggagagataaaatgtttataaattacaattaatcttgattttc |
9457309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University