View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_483 (Length: 239)
Name: NF11453A_low_483
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_483 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 8 - 239
Target Start/End: Complemental strand, 41103375 - 41103144
Alignment:
| Q |
8 |
gagatgaacaacatcggagaatcgtgtttcgctgatatttgcagagaaagcgcactgatgctgtttgcattcccggaaaacgtggcaaaatgcaagaaaa |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41103375 |
gagaagaacaacatcggagaatcgtgtttcgctgatatttgcagagaaagcgcattaatgctgtttgcattcccggaaaacgtggcaaaatgcaagaaaa |
41103276 |
T |
 |
| Q |
108 |
ctccggagaaaatgttcagaacgcttgatttatacgaagcgatttcagaaaattggaatcaaattgaatcaattttttcgtcggaatcaaactcaccgat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41103275 |
ctccggagaaaatgttcagaacgcttgatttatacgaagcgatttcagaaaattggaatcaaattgaatcaattttttcgtcggaatcaaactcaccgat |
41103176 |
T |
 |
| Q |
208 |
cagatcgcaagtcgttgcttcacaggttagac |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
41103175 |
cagatcgcaagtcgttgcttcacaggttagac |
41103144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 92 - 156
Target Start/End: Complemental strand, 23129108 - 23129044
Alignment:
| Q |
92 |
gcaaaatgcaagaaaactccggagaaaatgttcagaacgcttgatttatacgaagcgatttcaga |
156 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
23129108 |
gcaaaatgcaagaaaactcctgagaaaatgttcagaactcttgatttatacgaagcaatttcaga |
23129044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University