View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_484 (Length: 239)
Name: NF11453A_low_484
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_484 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 42888349 - 42888125
Alignment:
| Q |
1 |
agaaaaaccactttgacacggatatgatttagattctatggtgaatctttctctataatagcagtaacctatattttgatgacaatatcacacgttcaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42888349 |
agaaaaaccactttgacacggatatgatttagattctatggtgaatctttctctataatagcagtaacctatattttgatgacaatatcacacgttcaca |
42888250 |
T |
 |
| Q |
101 |
tactaaaatgcagtccgtacggttaaaccgtcagtggaaaaatcagtatatatattgatactataaaaaggaaaaggannnnnnnnctttctggcaaatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42888249 |
tactaaaatgcagtccgtacggttaaaccgtcagtggaaaaatcagtatatatattgatactataaaaaggaaaaggattttttttctttctggcaaatc |
42888150 |
T |
 |
| Q |
201 |
atatgcacattttatcatgcaaact |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
42888149 |
atatgcacattttatcatgcaaact |
42888125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University