View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_489 (Length: 238)
Name: NF11453A_low_489
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_489 |
 |  |
|
| [»] scaffold0191 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 14 - 197
Target Start/End: Complemental strand, 929929 - 929746
Alignment:
| Q |
14 |
cagaacctgtgctctcaatttttgcaacattgtggtatcaaaggtgggaagaaaggtaggaaattctcacatttatcgtgtatggatggatacaatctaa |
113 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
929929 |
cagaacccgtgctctcaatttttgcaacattgtggtatcaaaggtggtaagaaaggtaggaaattctcacatttatcgtgtatggatggatacaatctaa |
929830 |
T |
 |
| Q |
114 |
tgcattttgctaggtagaaatcaaattatctttgaaggaaactcaatgaatgtaagcggcatagtgtcgcatattaaaatggtt |
197 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
929829 |
tgcatttttctaggtagaaatcaaattatctttgaaggaaactcaatgaatgtaagcggcatagtgtcgcatattaaaatggtt |
929746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0191 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0191
Description:
Target: scaffold0191; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 26 - 88
Target Start/End: Original strand, 24919 - 24981
Alignment:
| Q |
26 |
tctcaatttttgcaacattgtggtatcaaaggtgggaagaaaggtaggaaattctcacattta |
88 |
Q |
| |
|
||||| || |||||||| ||||||||||||||||| ||||||| |||||||| |||||||||| |
|
|
| T |
24919 |
tctcatttattgcaacactgtggtatcaaaggtggtaagaaagataggaaatgctcacattta |
24981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University