View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_500 (Length: 235)
Name: NF11453A_low_500
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_500 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 28611371 - 28611244
Alignment:
| Q |
1 |
catgttattaccgcgtagcctgttaggttttatggttgatttgcaatgaaatttcttaacagaaatacatcagccgatgtaacatcaaacgcaattcaat |
100 |
Q |
| |
|
||||||||||| || || |||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28611371 |
catgttattactgcataacctgttaggttttatggttgatttttaatgaaatttcttaacaggaatacatcagccgatgcaacatcaaacgcaattcaat |
28611272 |
T |
|
| Q |
101 |
gaaagcataggaactaggcatgaacatc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
28611271 |
gaaagcataggaactaggcatgaacatc |
28611244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 130 - 207
Target Start/End: Complemental strand, 28611199 - 28611122
Alignment:
| Q |
130 |
aagacaatatcccaaatctaaacgataatatcaaattgaaacttttattaatcaacttttaatcattgcagcagaaca |
207 |
Q |
| |
|
||||||||||| |||| ||||| |||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
28611199 |
aagacaatatcataaatttaaacaataatatcaaattgaaacttttattaatgaacttttaatcattgcaacagaaca |
28611122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University