View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_505 (Length: 235)
Name: NF11453A_low_505
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_505 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 62 - 235
Target Start/End: Original strand, 15758159 - 15758328
Alignment:
| Q |
62 |
caacaaattcatgtttccttccatctgttctcgtttctcgccatttcttgctgatacgttctgtttcagtatttacatactacgtacgtactgtaatcat |
161 |
Q |
| |
|
||||||||||||||||||| | || |||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
15758159 |
caacaaattcatgtttcctccgatatgttttcgtttctcgccatttcctgttgatacgttctgtttcagtatttacatactacg----tactgtaatcat |
15758254 |
T |
|
| Q |
162 |
atattattcctagcctatggtttatttggttttgctattttcctttattgcattttaatttagaaccgaagata |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15758255 |
atattattcctagcctatggtttatttggttttgctattttcctttattgcattttaatttagaaccgacgata |
15758328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 219
Target Start/End: Complemental strand, 4257946 - 4257903
Alignment:
| Q |
176 |
ctatggtttatttggttttgctattttcctttattgcattttaa |
219 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
4257946 |
ctatggtttattttgctttgctattttcctttattgcattttaa |
4257903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University