View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_507 (Length: 235)
Name: NF11453A_low_507
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_507 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 7 - 235
Target Start/End: Complemental strand, 3016176 - 3015948
Alignment:
| Q |
7 |
tatcatagatgatggatttgtcagcattttgtgattgtcttagagttagattatcatttttaagatcttacatattaatattcttctaccattgtaagta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| ||||||| |||||| ||||||||| |
|
|
| T |
3016176 |
tatcatagatgatggatttgtcagcattttatgattgtcttagagttagattatcatttttaagatcatacatatcaatattcgtctaccgttgtaagta |
3016077 |
T |
 |
| Q |
107 |
aacaggcttgaggaataaaaagagaaaattgaagggggnnnnnnngctgatcaagattacagaaatcttgtgtcaactttctattacaatgttgtcatga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3016076 |
aacaggcttgaggaataaaaagagaaaattgaagggggaaaaaaagctgatcaagattacagaaatcttgtgtcaactttctattacaatgttgtcatgt |
3015977 |
T |
 |
| Q |
207 |
ttgaacttgatctcactattattacaatt |
235 |
Q |
| |
|
||||||||| ||||||||||||||||||| |
|
|
| T |
3015976 |
ttgaacttgttctcactattattacaatt |
3015948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University