View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_517 (Length: 231)
Name: NF11453A_low_517
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_517 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 11626548 - 11626413
Alignment:
| Q |
1 |
gctgacgtgtcaaacagcttttagcttaaacggatcaaaatccaattcctcgtgcactcatttcattgccaacatcgaaaaaaccgaaactctttcttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11626548 |
gctgacgtgtcaaacagcttttagcttaaacggatcaaaatccaattcctcgtgcactcatttcattgccaacatcgaaaaaaccgaaactctttcttca |
11626449 |
T |
|
| Q |
101 |
aaacaaacagaaaccttaactaataactgtctcgcgc |
137 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11626448 |
aaacaaaca-taaccttaactaataactgtctcgcgc |
11626413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 225
Target Start/End: Complemental strand, 11626367 - 11626323
Alignment:
| Q |
181 |
gatcttaagaaggaagaaatgattgaaactaaggaccctgaaatt |
225 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
11626367 |
gatcttaagaagaaaaaaatgattgaaactaaggaccctgaaatt |
11626323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University