View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_521 (Length: 231)
Name: NF11453A_low_521
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_521 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 30274722 - 30274508
Alignment:
| Q |
1 |
tctttatttaagacaaatctgtcattgtcacggtaggccatttatatgacatatgctaaatcaattacaacacatgtagcatcgacgttttatattgaag |
100 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30274722 |
tctttaatgaagacaaatctgtcattgtcacggtaggccatttatatgacatatgctaaatcaattacaacacatgtagcatcgacgctttatattgaag |
30274623 |
T |
|
| Q |
101 |
gcgtgagtgtcagacaacaacagtatagatacaacgctaacacatgtgataatatgcagtcatttttatgttatcactgatatttacgtgtcagtgtcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30274622 |
gcgtgagtgtcagacaacaacagtatagatacaacgctaacacatgtgataatatgcagtcatttttatgttatcattgatatttacgtgtcagtgtcat |
30274523 |
T |
|
| Q |
201 |
tgtcgtatctgatgt |
215 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
30274522 |
tgtcgtatctaatgt |
30274508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University