View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_524 (Length: 231)
Name: NF11453A_low_524
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_524 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 4e-37; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 31069443 - 31069529
Alignment:
| Q |
1 |
ttccttgtttgcctttcatgtcttcttccttcagcaaggtgatgttaagcttcaaaaccattccccctattcttcacatgtgtctct |
87 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31069443 |
ttccttgtttgcccttcatgtcttcttccttcagcaaggtgatgttaagcttcaaaaccattccccctattcttcacttgtgtctct |
31069529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 154 - 225
Target Start/End: Original strand, 31069596 - 31069667
Alignment:
| Q |
154 |
atgaagttgttcttctgctacttgaaagattttgtgggaagagaaatgacggtagaactcaagaataattta |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31069596 |
atgaagttgttcttctgctacttgaaagattttgcgggaagagaaatgacggtagaactcaagaatgattta |
31069667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 218
Target Start/End: Original strand, 37614334 - 37614398
Alignment:
| Q |
154 |
atgaagttgttcttctgctacttgaaagattttgtgggaagagaaatgacggtagaactcaagaa |
218 |
Q |
| |
|
|||||| ||||||||| ||||| |||||||| |||||||||||| ||||||| ||||||||||| |
|
|
| T |
37614334 |
atgaagctgttcttctcgtacttcaaagatttggtgggaagagaagtgacggttgaactcaagaa |
37614398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 218
Target Start/End: Original strand, 42440446 - 42440506
Alignment:
| Q |
158 |
agttgttcttctgctacttgaaagattttgtgggaagagaaatgacggtagaactcaagaa |
218 |
Q |
| |
|
|||||||||||| ||||| |||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
42440446 |
agttgttcttctcatacttcaaagatttggtgggaagagaagttacggtagaactcaagaa |
42440506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University