View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_540 (Length: 230)
Name: NF11453A_low_540
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_540 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 8e-48; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 116 - 224
Target Start/End: Complemental strand, 39187803 - 39187695
Alignment:
| Q |
116 |
ccgagttttacatgaacaagcagttgcttcttgttgtaaaatgaatttacttttaatttatacacaggcgtaaggatattaaggcgatgcatatgatgta |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39187803 |
ccgagttttacatgaacaaggagttgcttcttgttgtaaaatgaatttacttttaatctatacacaggcgtatggatattaaggcgatgcatatgatgta |
39187704 |
T |
|
| Q |
216 |
gtacattct |
224 |
Q |
| |
|
||||||||| |
|
|
| T |
39187703 |
gtacattct |
39187695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 39187915 - 39187829
Alignment:
| Q |
1 |
ttaaatgagaatgatgaacgaagaaatcaaatttgtgaggtatggctgctgtatctcatcttatagaaaatcaattctcttgtttac |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39187915 |
ttaaatgagaatgatgaacgaagaaatcaaatttgtgaggtatggctgctgtatctcatcttatagaaaatcaattctcttgtttac |
39187829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 38 - 86
Target Start/End: Complemental strand, 2889092 - 2889044
Alignment:
| Q |
38 |
aggtatggctgctgtatctcatcttatagaaaatcaattctcttgttta |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||| ||||||||||| |
|
|
| T |
2889092 |
aggtatggctgctgtctcccatcttatagaaaatcacatctcttgttta |
2889044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 38 - 86
Target Start/End: Original strand, 3145770 - 3145818
Alignment:
| Q |
38 |
aggtatggctgctgtatctcatcttatagaaaatcaattctcttgttta |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||| ||||||||||| |
|
|
| T |
3145770 |
aggtatggctgctgtctcccatcttatagaaaatcacatctcttgttta |
3145818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University